Previously identified motifs of midline and Tbx20. A) A schematic of

Previously identified motifs of midline and Tbx20. A) A schematic of D. melanogaster Midline protein based on clone RE27439 drawn using Prosite MyDomains [42]. The fragment used in our analysis ?green line (amino acids 171?93) spans the DNA binding Tbox domain ?blue box (amino acids 187?83). The EH1domain [19] in the N-terminal region is in orange. B) The DNA binding motif of mouse Tbx20 is derived from the site selection data presented by Macindoe et al. [6], while the mid DNA binding motif was generated from data by Liu et al. [18]. Comparison of the aligned motifs show that the two homologues only have positions 0? in common. Nucleotides at all other positions differ, suggesting that Drosophila Mid recognizes a different consensus sequence than that bound by other Tbx20 proteins. C) The binding consensus identified by Liu et al. (GGAAGTAGGTCAAG ) [18], full Brachyury palindrome (T-palindrome AATTTCACACCTAGGTGTGAAATT) [3] and the Tbx20 consensus derived by MacIndoe et al. (GGAGGTGTGAGGCGA) [6] were tested on an EMSA for interaction with the T-box domain of bacterially expressed Mid. doi:10.1371/journal.pone.0048176.gretard the migration of oligonucleotides containing either the Brachyury T-site or the vertebrate Tbx20 site. However, when MidTbx was incubated with the motif identified by Liu et al. (Figure 1B) we were unable to detect the presence of a lower mobility band (Figure 1C). This demonstrates that our bacterially expressed protein is capable of binding to DNA in vitro and that MidTbx has an affinity for the full T-site and the Tbx20 site but is unable to bind to the motif identified by Liu et al.The MidTbx Binding Motif Resembles a Classic get JI 101 T-half-siteIn order to determine the preferred sequences bound by Mid, we performed a site selection experiment. Using buffer conditions nearly identical to those described by Liu et al., we incubated double-stranded oligonucleotides containing a random 26 bp core flanked by 25 bp primer sequences with purified MidTbx. Following precipitation of the nucleo-protein complex using nickel beads and magnets, we washed off the unbound oligonucleotides, eluted the MidTbx-DNA complexes, and PCR PHCCC web amplified the selected fragments through 4 rounds of selection. We then cloned and sequenced 54 different oligonucleotides (Figure 2A). To reduce the background of oligonucleotides precipitated due to weak or non-specific binding, each cloned oligonucelotide was used to generate a biotin-labelled probe and tested by EMSA. Probes were considered unshifted if they failed to produce a visible band at least once in a minimum of three independent EMSAs (Figure 2B). MidTbx was able to shift 27 of the 54 cloned fragments in an EMSA (Figure 2B). Most (24/27) of the remaining probes displayed some evidence for binding to MidTbx such as the appearance of streaks along the edges of the gel lanes (Figure 2B arrows). However, this transient or weak binding was considered insufficient to include the sequence of those probes in our analysis. The corresponding sequences of the shifted probes were used to generate a binding motif using MEME software [20] and verified using SCOPE [21] and MochiView [22] (data not shown). Since all the probes were positive for an interaction with MidTbx, the parameters were set such that all 27 sequences were used to generate a motif. Our results show that MidTbx selects a 15 bp motif corresponding to the sequence [CG][ATG][AG][GA]GTG[TA][CGT][AG]A[GA]GCG or SDRRGTGWBRARGCG (Figure 3A). A 11967625 simi.Previously identified motifs of midline and Tbx20. A) A schematic of D. melanogaster Midline protein based on clone RE27439 drawn using Prosite MyDomains [42]. The fragment used in our analysis ?green line (amino acids 171?93) spans the DNA binding Tbox domain ?blue box (amino acids 187?83). The EH1domain [19] in the N-terminal region is in orange. B) The DNA binding motif of mouse Tbx20 is derived from the site selection data presented by Macindoe et al. [6], while the mid DNA binding motif was generated from data by Liu et al. [18]. Comparison of the aligned motifs show that the two homologues only have positions 0? in common. Nucleotides at all other positions differ, suggesting that Drosophila Mid recognizes a different consensus sequence than that bound by other Tbx20 proteins. C) The binding consensus identified by Liu et al. (GGAAGTAGGTCAAG ) [18], full Brachyury palindrome (T-palindrome AATTTCACACCTAGGTGTGAAATT) [3] and the Tbx20 consensus derived by MacIndoe et al. (GGAGGTGTGAGGCGA) [6] were tested on an EMSA for interaction with the T-box domain of bacterially expressed Mid. doi:10.1371/journal.pone.0048176.gretard the migration of oligonucleotides containing either the Brachyury T-site or the vertebrate Tbx20 site. However, when MidTbx was incubated with the motif identified by Liu et al. (Figure 1B) we were unable to detect the presence of a lower mobility band (Figure 1C). This demonstrates that our bacterially expressed protein is capable of binding to DNA in vitro and that MidTbx has an affinity for the full T-site and the Tbx20 site but is unable to bind to the motif identified by Liu et al.The MidTbx Binding Motif Resembles a Classic T-half-siteIn order to determine the preferred sequences bound by Mid, we performed a site selection experiment. Using buffer conditions nearly identical to those described by Liu et al., we incubated double-stranded oligonucleotides containing a random 26 bp core flanked by 25 bp primer sequences with purified MidTbx. Following precipitation of the nucleo-protein complex using nickel beads and magnets, we washed off the unbound oligonucleotides, eluted the MidTbx-DNA complexes, and PCR amplified the selected fragments through 4 rounds of selection. We then cloned and sequenced 54 different oligonucleotides (Figure 2A). To reduce the background of oligonucleotides precipitated due to weak or non-specific binding, each cloned oligonucelotide was used to generate a biotin-labelled probe and tested by EMSA. Probes were considered unshifted if they failed to produce a visible band at least once in a minimum of three independent EMSAs (Figure 2B). MidTbx was able to shift 27 of the 54 cloned fragments in an EMSA (Figure 2B). Most (24/27) of the remaining probes displayed some evidence for binding to MidTbx such as the appearance of streaks along the edges of the gel lanes (Figure 2B arrows). However, this transient or weak binding was considered insufficient to include the sequence of those probes in our analysis. The corresponding sequences of the shifted probes were used to generate a binding motif using MEME software [20] and verified using SCOPE [21] and MochiView [22] (data not shown). Since all the probes were positive for an interaction with MidTbx, the parameters were set such that all 27 sequences were used to generate a motif. Our results show that MidTbx selects a 15 bp motif corresponding to the sequence [CG][ATG][AG][GA]GTG[TA][CGT][AG]A[GA]GCG or SDRRGTGWBRARGCG (Figure 3A). A 11967625 simi.