Ant tissues will provide further insights into the mechanisms driving tumor growth and neural dysfunction in TSC disease.manually decapitated. Each set of heads was homogenized in equal volume (400 ml) of 2.5 sulfosalicylic acid, followed by centrifugation at 10,000 rpm for 15 minutes. All steps were done at 4uC. The clear supernatant was then analyzed using the Biochrom 30 amino acid CASIN supplier analyzer (Biochrom, Cambridge, UK).Western Blots and RT-PCRStage P10 pupae were collected and the dorsal thoraces were isolated by manual dissection. For real-time PCR twelve thoraces were collected for RNA extraction using the RNAeasy kit (Qiagen). Probesets used for RT-PCR: TH (TTGAGGAGGATGTTGAGTTTGAGA and CTCGGTGAGACCGTAATCGTT), Rheb (TGAGGTGGTGAAGATCATATACGAA and GCCAGCTTCTTGCCTTCCT) were run using Taqman/and spt4 control (CTCGTGGTACTCCTGCCATTTCTG and TCCACGATTCTTCATGTCACGTA) using cybergreen. Rheb and TH RNA levels were normalized to Spt4 levels in both control and Rheb overexpressing samples. For Western blots fifteen thoraces were collected, homogenized in RIPA buffer, run on a gel and protein transferred to a nitrocellulose membrane. Antibodies used for Western blot were Rabbit anti-Yellow (1:1000, generous gift from S. Carroll), rabbit antiTyrosine hydroxylase (1:1000,
W. Neckameyer), and mouse antiactin (Sigma).Supporting InformationFigure S1 Rheb overexpression increases pigmentation on the thorax and abdomen. Male pannier-Gal4 abdomen, showing the narrow dorsal pigment stripe in segments A3 and A4 (A). Rheb overexpression expands the dorsal pigment stripe (B). The RhebAV4 allele crossed to pannier-Gal4 shows a pigment patch on the thorax (C), and TSC2RNAi knockdown expands the dorsal pigment stripe (D). Raptor knockdown (raptorRNAi lines TRiP.JF01087 and TRiP.JF01088 (Kockel, Kerr, Melnick, et al, 2010)) suppressed Rheb-induced expansion of the dorsal pigment stripe on the male abdomen (E ). rictorRNAi (TRiP.JF01370) does not suppress Rheb-induced pigmentation on the thorax (H). Overexpression of either S6K1TE or S6K1STDETE enhances the thoracic Rheb-induced pigmentation (I, J). (TIF) Figure S2 Rheb induced Pigmentation is modulated by ebony. Compared to Rheb-overexpressing controls (A), ebony heterozygous mutant flies overexpressing Rheb exhibit a more pronounced posterior pigment patch on the thorax (B). Overexpression of Ebony suppresses the Rheb-induced pigmentation on the thorax (C), while pigmentation in pannier-Gal4, ebonyRNAi (D) is enhanced by Rheb overexpression (E). Fold change of Rheb and TH transcripts between UAS-Rheb, pannier-Gal4, and pannier-Gal4 thoraces. Rheb shows a 3.5 fold change, but no detectable change of TH (Wilcoxon test -*, F). Knockdown of the helicase eIF4A (using the TRiP line HMS00927) suppresses the bristle growth and increased pigmentation driven by Rheb in the pupal thorax (G). TH and Yellow 59UTRs. Predicted secondary structure and probability of base pairing of the tyrosine hydroxylase and yellow 59UTR using the RNAFold algorithm (bp = base pairs, minimum free energy calculation is shown in blue text, H). (TIF)Materials and Methods Drosophila Genetics, Live Imaging, and ImmunohistochemistryGenotypes of Drosophila strains used in this study are provided in the supplementary material. Unless otherwise noted, Drosophila stocks and MedChemExpress KS-176 crosses were maintained at 22uC on standard media. For mounting adult cuticles, flies were collected, stored and dissected in 80 isopropanol, then cleared and mounted in Hoyer’s med.Ant tissues will provide further insights into the mechanisms driving tumor growth and neural dysfunction in TSC disease.manually decapitated. Each set of heads was homogenized in equal volume (400 ml) of 2.5 sulfosalicylic acid, followed by centrifugation at 10,000 rpm for 15 minutes. All steps were done at 4uC. The clear supernatant was then analyzed using the Biochrom 30 amino acid analyzer (Biochrom, Cambridge, UK).Western Blots and RT-PCRStage P10 pupae were collected and the dorsal thoraces were isolated by manual dissection. For real-time PCR twelve thoraces were collected for RNA extraction using the RNAeasy kit (Qiagen). Probesets used for RT-PCR: TH (TTGAGGAGGATGTTGAGTTTGAGA and CTCGGTGAGACCGTAATCGTT), Rheb (TGAGGTGGTGAAGATCATATACGAA and GCCAGCTTCTTGCCTTCCT) were run using Taqman/and spt4 control (CTCGTGGTACTCCTGCCATTTCTG and TCCACGATTCTTCATGTCACGTA) using cybergreen. Rheb and TH RNA levels were normalized to Spt4 levels in both control and Rheb overexpressing samples. For Western blots fifteen thoraces were collected, homogenized in RIPA buffer, run on a gel and protein transferred to a nitrocellulose membrane. Antibodies used for Western blot were Rabbit anti-Yellow (1:1000, generous gift from S. Carroll), rabbit antiTyrosine hydroxylase (1:1000, W. Neckameyer), and mouse antiactin (Sigma).Supporting InformationFigure S1 Rheb overexpression increases pigmentation on the thorax and abdomen. Male pannier-Gal4 abdomen, showing the narrow dorsal pigment stripe in segments A3 and A4 (A). Rheb overexpression expands the dorsal pigment stripe (B). The RhebAV4 allele crossed to pannier-Gal4 shows a pigment patch on the thorax (C), and TSC2RNAi knockdown expands the dorsal pigment stripe (D). Raptor knockdown (raptorRNAi lines TRiP.JF01087 and TRiP.JF01088 (Kockel, Kerr, Melnick, et al, 2010)) suppressed Rheb-induced expansion of the dorsal pigment stripe on the male abdomen (E ). rictorRNAi (TRiP.JF01370) does not suppress Rheb-induced pigmentation on the thorax (H). Overexpression of either S6K1TE or S6K1STDETE enhances the thoracic Rheb-induced pigmentation (I, J). (TIF) Figure S2 Rheb induced Pigmentation is modulated by ebony. Compared to Rheb-overexpressing controls (A), ebony heterozygous mutant flies overexpressing Rheb exhibit a more pronounced posterior pigment patch on the thorax (B). Overexpression of Ebony suppresses the Rheb-induced pigmentation on the thorax (C), while pigmentation in pannier-Gal4, ebonyRNAi (D) is enhanced by Rheb overexpression (E). Fold change of Rheb and TH transcripts between UAS-Rheb, pannier-Gal4, and pannier-Gal4 thoraces. Rheb shows a
3.5 fold change, but no detectable change of TH (Wilcoxon test -*, F). Knockdown of the helicase eIF4A (using the TRiP line HMS00927) suppresses the bristle growth and increased pigmentation driven by Rheb in the pupal thorax (G). TH and Yellow 59UTRs. Predicted secondary structure and probability of base pairing of the tyrosine hydroxylase and yellow 59UTR using the RNAFold algorithm (bp = base pairs, minimum free energy calculation is shown in blue text, H). (TIF)Materials and Methods Drosophila Genetics, Live Imaging, and ImmunohistochemistryGenotypes of Drosophila strains used in this study are provided in the supplementary material. Unless otherwise noted, Drosophila stocks and crosses were maintained at 22uC on standard media. For mounting adult cuticles, flies were collected, stored and dissected in 80 isopropanol, then cleared and mounted in Hoyer’s med.